Ritu IVF Logo
1

Next-Generation Genomic Testing for Family Planning

Advanced genetic insights to help you build a healthy family and prevent inherited conditions.

Comprehensive genetic screening for 300+ inherited conditions

State-of-the-art embryo testing for IVF procedures

Personalized consultation with genetic specialists

Increased chances of healthy pregnancies and births

Learn More
ATCGATCGATCGATCGATCGATCG
ATCGATCGATCGATCGATCGATCG
ATCGATCGATCGATCGATCGATCG
ATCGATCGATCGATCGATCGATCG
ATCGATCGATCGATCGATCGATCG
ATCGATCGATCGATCGATCGATCG
ATCGATCGATCGATCGATCGATCG
ATCGATCGATCGATCGATCGATCG
ATCGATCGATCGATCGATCGATCG
ATCGATCGATCGATCGATCGATCG

Genetic Testing

Analyze your DNA for comprehensive genetic insights

98%

Test Accuracy

300+

Genetic Conditions Screened

72%

Increased IVF Success Rate

24/7

Support Throughout Process

Benefits of Genomic Testing

Our comprehensive genomic services provide several key advantages for your fertility journey and future family health.

Prevent Genetic Disorders

Identify and prevent the transfer of over 300 genetic disorders to your child.

Healthier Children

Give your children the best start in life with reduced risk of genetic conditions.

Understand Your Risks

Get insights into your genetic predispositions and take preventive measures.

Personalized Care

Receive treatment plans tailored to your unique genetic profile.

Save Time & Emotion

Avoid multiple failed pregnancies or treatments by identifying issues early.

Improve IVF Success

Significantly increase the success rate of your IVF treatments.

How It Works

Our simple, patient-friendly process makes genomic testing accessible and straightforward.

1Book Consultation

Schedule your initial consultation with our genomics specialists.

2Sample Collection

Simple blood draw or cheek swab to collect your DNA sample.

3Lab Analysis

Advanced testing of your sample using the latest sequencing technology.

4Results Preparation

Our experts compile and analyze your genetic information.

5Results Consultation

We explain your results and provide personalized recommendations.

6Personalized Plan

Develop a customized treatment or family planning strategy.

Success Stories

Hear from patients who have benefited from our genomic testing services.

The genomic screening gave us peace of mind knowing our children wouldn't inherit the genetic condition that runs in my family. We now have two healthy children thanks to this amazing technology.

S

Sarah & Michael

Parents of Two

After two failed IVF cycles, we opted for genetic testing. Learning about our embryos' genetic health helped us make informed decisions, and we're now expecting our first child!

E

Emma Johnson

IVF Patient

The testing process was simple, and the genetic counseling was incredibly informative. We better understand our risks and feel empowered about our family planning choices.

T

Thomas & Rebecca

Expectant Parents

Frequently Asked Questions

Get answers to the most common questions about genomic testing and its role in fertility treatment.

Begin Your Journey to Informed Family Planning

Our genomic experts are ready to guide you through the process and help you make the best decisions for your future family.

No obligation • Most insurance plans accepted

Ready to Begin Your Journey to Parenthood?

Our team of fertility specialists is ready to guide you through every step of your fertility journey.

No waiting lists • Same-week appointments available